pDD317 (Pmyo-2::GFP + SEC)
(Plasmid #73344)

• Purpose: SEC vector carry Pmyo-2::GFP and ccdB sites for cloning homology arms
• Depositing Lab: Bob Goldstein
• Publication: Hibshman et al BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0.

Backbone

• Vector backbone: pUC19 (modified)
• Backbone size w/o insert (bp): 2600
• Total vector size (bp): 11900
• Modifications to backbone: Addition of ccdB markers to facilitate homology arm cloning
• Vector type: Worm Expression, Cre/Lox, CRISPR
• Selectable markers: Hygromycin ; sqt-1(d) (worm phenotypic marker)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Turbo
• Growth instructions: The dual ccdB sites in this vector may make it prone to recombination. It is recommended to pick several single clones and test by restriction digestion before use. This construct should be maintained as a purified plasmid stock in addition to a bacterial stock in case there is a need to re-transform.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Pmyo-2::GFP + SEC
• Species: C. elegans (nematode), Synthetic
• Insert Size (bp): 7900
• Promoter: myo-2
• Tag / Fusion Protein:
  • GFP

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: M13 Forward (tgtaaaacgacggccagt)
• 3′ sequencing primer: M13 Reverse (caggaaacagctatgaccatg)

Resource Information

• Supplemental Documents:
  • Annotated Sequence (Genbank format)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pDD317 is a derivative of our published vectors pDD282-285 (Dickinson et al. Genetics 2015) and is intended for making gene knockouts. It has a Pmyo-2::GFP expression cassette (bright pharyngeal fluorescence) in place of the simple fluorescent protein found in our other FP–SEC vectors. Pmyo-2::GFP + SEC is intended to be inserted in place of an entire ORF such that after insertion and SEC removal, the knockout is marked with Pmyo-2::GFP. The vector also has Lox511I sites in place of LoxP, allowing pDD315 to be used in a genetic background that has already been modified using a green or red FP-SEC vector, without conflicts between Lox sites.