GlgA1-Ptrc-GPPS-FNI-MK-PMD-PMK-SmR-psbA2
(Plasmid
#73340)
-
PurposeExpresses the GPPS gene plus the lower MVA pathway from Streptococcus pneumoniae
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73340 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescript KS+
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 2905
- Total vector size (bp) 10262
-
Selectable markersStreptomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPPS-FNI-MK-PMD-PMK-SmR
-
Alt nameLower MVA pathway from Streptococcus pneumoniae
-
SpeciesPicea abies and Streptococcus pneumoniae
-
GenBank IDGPPS2 (EU432047.2), MK (AAK99142.1), PMD (AAK99143.1), PMK (AAK99144.1), FNI (AAK99145.1)
- Promoter Ptrc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site SacI (unknown if destroyed)
- 5′ sequencing primer GTCCCAAATTCTTGATCCCATCC
- 3′ sequencing primer GTGGTCTTGATCGCTCGAGCTC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GlgA1-Ptrc-GPPS-FNI-MK-PMD-PMK-SmR-psbA2 was a gift from Anastasios Melis (Addgene plasmid # 73340)