PsbA2-HMGS-HMGR-ATOB-NPTI
(Plasmid #73338)

• Purpose: Construct expressing the upper MVA pathway in Synechocystis PCC 6803
• Depositing Lab: Anastasios Melis
• Publication: Expression of the MVA pathway in cyanobacteria (unpublished)

Backbone

• Vector backbone: PUC57 Genescript
• Backbone size w/o insert (bp): 2657
• Total vector size (bp): 9332
• Selectable markers: Kanamycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HMGS-HMGR-ATOB-NPTI
• Alt name: Upper MVA pathway genes
• Species: Enterococcus faecalis and Escherichia coli
• Insert Size (bp): 6675
• GenBank ID: HMGS (AAO81154.1), HMGR (AAO81155.1), ATOB (AKK18188.1),
• Promoter: psbA2

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (unknown if destroyed)
• 3′ cloning site: AscI (unknown if destroyed)
• 5′ sequencing primer: ACGATTGCGGCTTTAGCGTTC
• 3′ sequencing primer: GGCGATCGCCCGTTACAATT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there are a few discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies are not within the insert region and do NOT affect plasmid function.