Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CpcB•PHLS+Cpc
(Plasmid #73335)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73335 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBluescript KS+
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 2877
  • Total vector size (bp) 6991

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cpcB•PHLS-CmR
  • Species
    Synechocystis PCC 6803
  • Insert Size (bp)
    2960
  • Promoter cpc operon

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site SacI (unknown if destroyed)
  • 5′ sequencing primer TCGAGaagagtccctgaatatc
  • 3′ sequencing primer gccatcaatgctctgagctag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CpcB•PHLS+Cpc was a gift from Anastasios Melis (Addgene plasmid # 73335 ; http://n2t.net/addgene:73335 ; RRID:Addgene_73335)
  • For your References section:

    A phycocyanin.phellandrene synthase fusion enhances recombinant protein expression and beta-phellandrene (monoterpene) hydrocarbons production in Synechocystis (cyanobacteria). Formighieri C, Melis A. Metab Eng. 2015 Nov;32:116-24. doi: 10.1016/j.ymben.2015.09.010. Epub 2015 Sep 26. 10.1016/j.ymben.2015.09.010 PubMed 26410450