pCfB3052(gRNA X-4, XI-3, XII-5)
(Plasmid #73294)

• Purpose: EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-4, XI-3, and XII-5
• Depositing Lab: Irina Borodina
• Publication: Jessop-Fabre et al Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.

Backbone

• Vector backbone: pESC-Leu
• Backbone manufacturer: Agilent
• Backbone size w/o insert (bp): 7758
• Total vector size (bp): 6145
• Modifications to backbone: Gal promoters and terminators removed and Leu selectable marker replaced with NatMX marker. Modified to accept enable USER cloning, with the 20bp recognition sequence replaced to target site X-4, XI-3, XII-5 as reported in: Ronda, C., Maury, J., Jakočiūnas, T., Jacobsen, S. A. et al., CrEdit: CRISPR mediated multi-loci gene integration in Saccharomyces cerevisiae. Microb. Cell Fact. 2015, 14, 97.
• Vector type: Yeast Expression, CRISPR ; gRNA
• Selectable markers: nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: guiding RNA
• gRNA/shRNA sequence: cgccattcaagagcagcaac,ATATGTCTCTAATTTTGGAA, ttgtcacagtgtcacatcag
• Species: S. cerevisiae (budding yeast)

Resource Information

• Supplemental Documents:
  • pCfB3052(gRNA X-4, XI-3, XII-5)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that mutation A40T in nourseothricin was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.