Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mHDAC7-Unspliced (23-938) pEF6-Flag (MJS_018)
(Plasmid #73269)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73269 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEF6/V5-His
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5840
  • Total vector size (bp) 8535
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HDAC7
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2752
  • GenBank ID
    NM_001204278.1
  • Entrez Gene
    Hdac7 (a.k.a. 5830434K02Rik, HD7, HD7a, Hdac7a, mFLJ00062)
  • Tag / Fusion Protein
    • Flag (C terminal on backbone)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mHDAC7-Unspliced (23-938) pEF6-Flag (MJS_018) was a gift from Matthew Sweet (Addgene plasmid # 73269 ; http://n2t.net/addgene:73269 ; RRID:Addgene_73269)
  • For your References section:

    Histone deacetylase 7 promotes Toll-like receptor 4-dependent proinflammatory gene expression in macrophages. Shakespear MR, Hohenhaus DM, Kelly GM, Kamal NA, Gupta P, Labzin LI, Schroder K, Garceau V, Barbero S, Iyer A, Hume DA, Reid RC, Irvine KM, Fairlie DP, Sweet MJ. J Biol Chem. 2013 Aug 30;288(35):25362-74. doi: 10.1074/jbc.M113.496281. Epub 2013 Jul 12. 10.1074/jbc.M113.496281 PubMed 23853092