pSLC-246
(Plasmid #73190)

• Purpose: Template plasmid which encodes kanamycin resistance gene for positive selection and toxin gene (tse2) under the control of rhamnose induceable promoter (PrhaB) for negative selection.
• Depositing Lab: Swaine Chen
• Publication: Khetrapal et al Nucleic Acids Res. 2015 Jul 27;43(13):e83. doi: 10.1093/nar/gkv248. Epub 2015 Mar 23.

Backbone

• Vector backbone: pKD4
• Backbone manufacturer: Barry L. Wanner
• Backbone size w/o insert (bp): 3300
• Total vector size (bp): 4760
• Modifications to backbone: First inserted SmaI, AatII, SacII sites and chloramphenicol resistance gene at Afe1 site, followed by insertion of PrhaB-tse2 at SmaI site using blunt cloning.
• Vector type: Bacterial Expression
• Selectable markers: Ampicillin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Pir1
• Growth instructions: Add 2% glucose
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PrhaB-tse2
• GenBank ID: NC_002516.2
• Promoter: PrhaB

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (destroyed during cloning)
• 3′ cloning site: SmaI (destroyed during cloning)
• 5′ sequencing primer: 5’ CGGAATCGTTTTCCGGGACG 3’
• 3′ sequencing primer: 5’ ATTAGCCATGGTCCATATGA 3’

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry