-
PurposeTemplate plasmid which encodes a toxin gene (relE) under the control of rhamnose induceable promoter (PrhaB) to be used as a negative selection marker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73163 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKD4
-
Backbone manufacturerBarry L. Wanner
- Backbone size w/o insert (bp) 3300
- Total vector size (bp) 4549
-
Modifications to backboneFirst inserted SmaI, AatII, SacII sites and chloramphenicol resistance gene at Afe1 site in pKD4, followed by insertion of PrhaB-relE at SmaI site using blunt cloning.
-
Vector typeBacterial Expression
-
Selectable markersAmpicillin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Growth instructionsAdd 2% glucose to reduce toxicity.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePrhaB-relE
-
SpeciesE. coli (bacteria)
-
Insert Size (bp)1264
-
Entrez GenerelE (a.k.a. b1563, ECK1557, JW1555)
- Promoter PrhaB
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site SmaI (destroyed during cloning)
- 5′ sequencing primer CGGAATCGTTTTCCGGGACG
- 3′ sequencing primer ATTAGCCATGGTCCATATGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLC-217 was a gift from Swaine Chen (Addgene plasmid # 73163 ; http://n2t.net/addgene:73163 ; RRID:Addgene_73163) -
For your References section:
A set of powerful negative selection systems for unmodified Enterobacteriaceae. Khetrapal V, Mehershahi K, Rafee S, Chen S, Lim CL, Chen SL. Nucleic Acids Res. 2015 Jul 27;43(13):e83. doi: 10.1093/nar/gkv248. Epub 2015 Mar 23. 10.1093/nar/gkv248 PubMed 25800749