YIP sHRPa-Aga1P
(Plasmid #73151)

• Purpose: Large fragment of split HRP fused to the N-terminus of the yeast mating protein Aga1P. When linearized, this vector incorporates into the yeast genome.
• Depositing Lab: Alice Ting
• Publication: Martell et al Nat Biotechnol. 2016 May 30. doi: 10.1038/nbt.3563.

Backbone

• Vector backbone: YIP
• Backbone size w/o insert (bp): 4781
• Total vector size (bp): 7709
• Vector type: Yeast Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sHRPa-Aga1P
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 2925
• Promoter: glyceraldehyde-3-phosphate dehydrogenase GPD promoter (constitutive)
• Tag / Fusion Protein:
  • V5 tag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AflII (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: atgacattatctttcgctcattttacctacct

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sHRPa is the large split HRP fragment. It consists of amino acids 1-213 of horseradish peroxidase (HRP) with the following 4 mutations: T21I, P78S, R93G, N175S.

The insert contains the following features:
BamHI-Aga1P ss-AflII-sHRPa-3 aa linker-V5 epitope tag-9 aa linker-NheI-Aga1P mature-stop-XhoI

glyceraldehyde-3-phosphate dehydrogenase
GPD promoter (constitutive)
3 aa linker: GSG
9 aa linker: GSGGGGSSG
V5 epitope tag: GKPIPNPLLGLDST

This plasmid was derived from the previously published “LAP-Aga1P” plasmid (White and Zegelbone, Biochemistry, 52, 3728-3739, 2013). When this vector is linearized by restriction digest, it incorporates into the yeast genome.