Synapsin sHRPa-NRX in FSW lentiviral vector
(Plasmid #73147)

• Purpose: Large fragment of split HRP fused to the extracellular terminus of neurexin3B. This is a lentiviral plasmid, but can also be used for transfections. Synapsin promoter.
• Depositing Lab: Alice Ting
• Publication: Martell et al Nat Biotechnol. 2016 May 30. doi: 10.1038/nbt.3563.

Backbone

• Vector backbone: FSW lentiviral vector
• Backbone size w/o insert (bp): 8451
• Total vector size (bp): 10485
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sHRPa-NRX
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2034
• Promoter: Synapsin
• Tags / Fusion Proteins:
  • Flag tag
  • 2x HA tag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: CTCCCCTTCCCGGCCACCTTGGTCG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sHRPa is the large split HRP fragment. It consists of amino acids 1-213 of horseradish peroxidase (HRP) with the following 4 mutations: T21I, P78S, R93G, N175S.

The plasmid contains the following features (including promoter region):
PacI-SynapsinP-XbaI- NRX3β ss-AgeI-sHRPa-5 aa linker-flag-MfeI-NRX(36-330 aa)-2x HA-NRX(331-429 aa)-stop-AscI

Human synapsin promoter
5 aa linker: GSGSG
Lentiviral vector. Derived from FCGW with human synapsin1 promoter replacing CMV.