CAG sHRPb-FKBP-post mGRASP
(Plasmid #73146)

• Purpose: Small fragment of split HRP and FKBP fused to the extracellular terminus of the "post mGRASP" scaffold published by Magee, in which the majority of the NLG1 extracellular domain is deleted.
• Depositing Lab: Alice Ting
• Publication: Martell et al Nat Biotechnol. 2016 May 30. doi: 10.1038/nbt.3563.

Backbone

• Vector backbone: pCAG
• Backbone size w/o insert (bp): 4247
• Total vector size (bp): 5731
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sHRPb-FKBP-post mGRASP
• Species: Synthetic
• Insert Size (bp): 1470
• Promoter: CAG
• Tag / Fusion Protein:
  • HA tag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: MfeI (not destroyed)
• 5′ sequencing primer: gctaaccatgttcatgccttc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sHRPb is the small split HRP fragment. It consists of amino acids 214-308 of horseradish peroxidase (HRP) with the following 2 mutations: N255D, L299R

The insert contains the following features:
EcoRI-NLG1 ss-AgeI-sHRPb-10 aa linker-XhoI-FKBP12-HA epitope tag-MfeI-NLG1(630-843 aa)-stop-BglII-NotI

CAG promoter
10 aa linker: KGSGSTSGSG
HA epitope tag: YPYDVPDYA
FKBP12: We used a 107 aa sequence that is identical to chain A in PDB 2FAP.

This construct is identical to the previously reported “post-mGRASP” (Addgene ID 34912) except that 5 aa linker, HA tag, AgeI, and MfeI are added here, and residues 630-843 of NLG1 are used here instead of residues 627-843.