CAG sHRPb-NLG
(Plasmid #73144)

• Purpose: Small fragment of split HRP fused to the extracellular terminus of NLG1. CAG promoter.
• Depositing Lab: Alice Ting
• Publication: Martell et al Nat Biotechnol. 2016 May 30. doi: 10.1038/nbt.3563.

Backbone

• Vector backbone: pCAG
• Backbone size w/o insert (bp): 4247
• Total vector size (bp): 7147
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sHRPb-NLG
• Species: M. musculus (mouse), Synthetic
• Insert Size (bp): 2886
• Entrez Gene: Nlgn1 (a.k.a. 6330415N05Rik, NL1, Nlg1, mKIAA1070)
• Promoter: CAG
• Tag / Fusion Protein:
  • V5 tag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: MfeI (not destroyed)
• 5′ sequencing primer: GCTAACCATGTTCATGCCTTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sHRPb is the small split HRP fragment. It consists of amino acids 214-308 of horseradish peroxidase (HRP) with the following 2 mutations: N255D, L299R

The insert contains the following features:
EcoRI-NLG1 ss-AgeI-sHRPb-5 aa linker-V5 epitope tag-MfeI-NLG1-stop-BglII-NotI

CAG promoter
5 aa linker: GSGSG
V5 epitope tag: GKPIPNPLLGLDST
NLG: mouse neuroligin1
This construct was derived from the 3xAP-NLG1 plasmid (Addgene ID 43923).