CAG sHRPa-NRX
(Plasmid #73143)

• Purpose: Large fragment of split HRP fused to the extracellular terminus of neurexin3B. CAG promoter.
• Depositing Lab: Alice Ting
• Publication: Martell et al Nat Biotechnol. 2016 May 30. doi: 10.1038/nbt.3563.

Backbone

• Vector backbone: pCAG
• Backbone size w/o insert (bp): 4247
• Total vector size (bp): 6281
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: sHRPa-NRX
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2034
• Promoter: CAG
• Tags / Fusion Proteins:
  • Flag
  • 2x HA tag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: gctaaccatgttcatgccttc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

sHRPa is the large split HRP fragment. It consists of amino acids 1-213 of horseradish peroxidase (HRP) with the following 4 mutations: T21I, P78S, R93G, N175S.

The insert contains the following features:
EcoRI- NRX3Beta ss-AgeI-sHRPa-5 aa linker-flag-MfeI-NRX(36-330 aa)-2x HA-NRX(331-429 aa)-stop-HindIII

5 aa linker: GSGSG
HA: YPYDVPDYA
NRX: human neurexin3β with 2 HA tags inserted internally, derived from a construct from Thomas Südhof (Gokce and Südhof, J. Neurosci., 33, 14617-14628, 2013).