tetO-FUW-eGFP-RHOA-Q63L
(Plasmid #73081)

• Purpose: Lentiviral transfer vector for tet-inducible expression of EGFP tagged human RHOA-Q63L
• Depositing Lab: Andrew Putnam
• Publication: Kong et al Sci Rep. 2013 Dec 11;3:3474. doi: 10.1038/srep03474.

Backbone

• Vector backbone: FUW
• Backbone manufacturer: homemade
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RHOA-Q63L
• Species: H. sapiens (human)
• Insert Size (bp): 582
• Mutation: Q63L Constitutively active
• Entrez Gene: RHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
• Tag / Fusion Protein:
  • eGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GTGCCCACAGTGTTTGAGAA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pcDNA3-EGFP-RhoA-T19N (#12967). This vector came from the Scripps Research Institute via Addgene.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry