Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1_SNORD2 probe
(Plasmid #73070)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73070 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SNORD2
  • Species
    H. sapiens (human)
  • Entrez Gene
    SNORD2 (a.k.a. R39B, SNR39B)
  • Promoter t7

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer ccttaaagtgaaatgatggc
  • 3′ sequencing primer ATAATCAAGTGATCAGCAATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1_SNORD2 probe was a gift from Stefan Stamm (Addgene plasmid # 73070 ; http://n2t.net/addgene:73070 ; RRID:Addgene_73070)
  • For your References section:

    Dual function of C/D box small nucleolar RNAs in rRNA modification and alternative pre-mRNA splicing. Falaleeva M, Pages A, Matuszek Z, Hidmi S, Agranat-Tamir L, Korotkov K, Nevo Y, Eyras E, Sperling R, Stamm S. Proc Natl Acad Sci U S A. 2016 Mar 22;113(12):E1625-34. doi: 10.1073/pnas.1519292113. Epub 2016 Mar 8. 10.1073/pnas.1519292113 PubMed 26957605