pRR-AR
(Plasmid #73045)

• Purpose: Constitutively expresses the androgen receptor, which is required for the activation of the promoter in pLAREG (Addgene plasmid #73045)
• Depositing Lab: David McMillen
• Publication: Mazumder et al Nucleic Acids Res. 2014 Aug;42(14):9514-22. doi: 10.1093/nar/gku651. Epub 2014 Jul 23.

Backbone

• Vector backbone: pRW95-3
• Backbone manufacturer: PMID: 8800671
• Total vector size (bp): 8889
• Vector type: Yeast Expression
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Androgen receptor
• Species: H. sapiens (human)
• Mutation: please see depositor comments below
• Entrez Gene: AR (a.k.a. AIS, AR8, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM)
• Promoter: glyceraldehyde phosphate dehydrogenase (GPD)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GPDpro (CGGTAGGTATTGATTGTAATTCTG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there are several discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

This plasmid is a non-integrative plasmid that maintains approximately a single copy per cell and was used to express the glyceraldehyde phosphate dehydrogenase (GPD) driven androgen receptor gene. pRR-AR-5Z, a gift from Charles Miller (Addgene plasmid # 23058) was modified by excising the 5RE-cyc and lacZ portions using the BlpI and AatII restriction enzymes to create pRR-AR.