pET28-Mff(1-61)-PP-GST
(Plasmid #73042)

• Purpose: Bacterial expression of mouse Mff residues 1-61 with C-terminal GST-tag and PreScission protease cleavage site
• Depositing Lab: David Chan
• Publication: Liu et al Mol Biol Cell. 2015 Dec 1;26(24):4466-77. doi: 10.1091/mbc.E15-08-0591. Epub 2015 Oct 7.

Backbone

• Vector backbone: pET28a(+)
• Backbone manufacturer: EMD Millipore (Novagen)
• Modifications to backbone: A pET21b promoter (BglII/BamHI), followed by a PreScission protease site (BamHI/HindIII) and the GST sequence from pGEX6P1 (NotI/XhoI, Amersham) replaces the region between BglII/XhoI of pET28a(+)
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Mff(1-61)
• Alt name: mitochondrial fission factor
• Species: M. musculus (mouse)
• Mutation: Truncation containing amino acids 1-61
• Entrez Gene: Mff (a.k.a. 5230400G24Rik)
• Promoter: T7
• Tags / Fusion Proteins:
  • PreScission protease site (C terminal on backbone)
  • GST-tag (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: CTAGTTATTGCTCAGCGGTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry