pTU2-a-RFP
(Plasmid
#72958)
-
PurposeLevel 2 Destination vector - Position A - Assembly of 2 TU's from Level 1-AB
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSB1C3
-
Backbone manufactureriGEM
- Backbone size w/o insert (bp) 3185
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLevel 2 - a site
-
Alt nameRFP
-
SpeciesSynthetic
-
MutationCAT gene - C435G (nucleotide) - silent mutagenesis to remove BsmBI site
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer VF2 (5' tgccacctgacgtctaagaa 3')
- 3′ sequencing primer VR (5' attaccgcctttgagtgagc 3') (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTU2-a-RFP was a gift from Paul Freemont (Addgene plasmid # 72958 ; http://n2t.net/addgene:72958 ; RRID:Addgene_72958) -
For your References section:
EcoFlex: A Multifunctional MoClo Kit for E. coli Synthetic Biology. Moore SJ, Lai HE, Kelwick RJ, Chee SM, Bell DJ, Polizzi KM, Freemont PS. ACS Synth Biol. 2016 May 2. 10.1021/acssynbio.6b00031 PubMed 27096716