pLZRS-IRES-deltaNGFR
(Plasmid #72930)

• Purpose: (Empty Backbone) retroviral expression with FACS-selectable marker (extracellular part of NGFR)
• Depositing Lab: Esther van de Vosse
• Publication: van_de_Vosse et al Blood. 2009 May 7;113(19):4548-55. doi: 10.1182/blood-2008-12-196220. Epub 2009 Mar 3.

Backbone

• Vector backbone: pLZRS-IRES-deltaNGFR
• Backbone manufacturer: Roel de Paus
• Backbone size (bp): 12878
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: gcccacgtgaaggctgccgacc
• 3′ sequencing primer: acgttaggggggggggagggagag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Extracellular domain of NGFR is expressed in tandem with the insert, thus allowing FACS selection of cells retrovirally expressing the insert.

Discrepancies between the full and QC sequence should not have any functional consequence.

This plasmid has been found to be somewhat unstable and prone to recombination. You may need to screen multiple colonies to isolate the full-length, monomeric version of this plasmid.