Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Gg 3kb Green opsin GFP
(Plasmid #72919)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72919 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAGGS
  • Modifications to backbone
    no basal GFP Hsiau TH, Diaconu C, Myers CA, Lee J, Cepko CL, Corbo JC.2007. The cis-regulatory logic of the mammalian photore-ceptor transcriptional network. PloS One 2:e643.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    chicken green opsin promoter
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    2967

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer TGTGACAGGGACACTGAAGG
  • 3′ sequencing primer TATTATGGCAGCTGCTTTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Gg 3kb Green opsin GFP was a gift from Joseph Corbo (Addgene plasmid # 72919 ; http://n2t.net/addgene:72919 ; RRID:Addgene_72919)
  • For your References section:

    Transcriptome profiling of developing photoreceptor subtypes reveals candidate genes involved in avian photoreceptor diversification. Enright JM, Lawrence KA, Hadzic T, Corbo JC. J Comp Neurol. 2015 Mar 1;523(4):649-68. doi: 10.1002/cne.23702. Epub 2014 Dec 1. 10.1002/cne.23702 PubMed 25349106