N1-mSin1.1-GFP
(Plasmid #72907)

• Purpose: GFP-tagged mSin1 (isoform 1)
• Depositing Lab: Ivan Yudushkin
• Publication: Ebner et al J Cell Biol. 2017 Jan 31. pii: jcb.201610060. doi: 10.1083/jcb.201610060.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 6290
• Modifications to backbone: Kozak and start ATG before eGFP were mutated: caccatgg to aaccttgg Linker was added before Kozak (aaccttgg): cgggcccgggatccaccggtcgc
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mSin1.1
• Alt name: MAPKAP1
• Alt name: stress-activated map kinase interacting protein 1
• Species: H. sapiens (human)
• Insert Size (bp): 1566
• Entrez Gene: MAPKAP1 (a.k.a. JC310, MIP1, SIN1, SIN1b, SIN1g)
• Promoter: CMV
• Tag / Fusion Protein:
  • eGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: SacII (not destroyed)
• 5′ sequencing primer: taacaactccgccccatt
• 3′ sequencing primer: tccagctcgaccaggatgg

Resource Information

• Supplemental Documents:
  • .ape map file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

mSin1.1 was amplified from HEK293 cDNA library