pHR-FKBP:mCherry-KRas4Bc30
(Plasmid #72900)

• Purpose: Membrane-targeted mCherry-tagged recruiter construct
• Depositing Lab: Ivan Yudushkin
• Publication: Ebner et al J Cell Biol. 2017 Jan 31. pii: jcb.201610060. doi: 10.1083/jcb.201610060.

Backbone

• Vector backbone: pHR'
• Total vector size (bp): 10112
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GTPase K-Ras
• Alt name: KRas4B (isoform 2B)
• Species: H. sapiens (human)
• Mutation: amino acids 158..188 (fragment 1..157 deleted)
• GenBank ID: NM_004985.4
• Entrez Gene: KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
• Tags / Fusion Proteins:
  • FKBP (N terminal on insert)
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: gcttcccgagctctataaaagagc
• 3′ sequencing primer: ccagaggttgattatcgataagc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry