pcDNA3.1-CAG-LMO1 (GLuc-ChR2-EYFP)
(Plasmid
#72888)
-
Purposefusion protein of Gaussia luciferase, Channelrhodopsin-2, and enhanced yellow fluorescent protein for bioluminescent optogenetics
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72888 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5427
- Total vector size (bp) 7759
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGaussia luciferase
-
Alt nameGLuc
-
SpeciesGaussia princeps
-
Insert Size (bp)555
- Promoter CAG
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AAGCTTGCCACCATGGGAGTCAAAGTT
- 3′ sequencing primer GGATCCCCGTCACCACCGGCCCCCTTGAT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameChannelrhodopsin-2
-
Alt nameChR2
-
Specieschlamydomonas
-
Insert Size (bp)930
Gene/Insert 3
-
Gene/Insert nameenhanced yellow fluorescent protein
-
Alt nameEYFP
-
Speciessynthetic
-
Insert Size (bp)720
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-CAG-LMO1 (GLuc-ChR2-EYFP) was a gift from Ute Hochgeschwender (Addgene plasmid # 72888 ; http://n2t.net/addgene:72888 ; RRID:Addgene_72888) -
For your References section:
Light-emitting channelrhodopsins for combined optogenetic and chemical-genetic control of neurons. Berglund K, Birkner E, Augustine GJ, Hochgeschwender U. PLoS One. 2013;8(3):e59759. doi: 10.1371/journal.pone.0059759. Epub 2013 Mar 27. PONE-D-12-38868 [pii] PubMed 23544095