Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

shGLDC-DOX
(Plasmid #72883)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72883 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO-GC11
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RNAi hairpin against GLDC
  • gRNA/shRNA sequence
    GAAGTTTATGAGTCTCCATTT
  • Species
    H. sapiens (human)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age1 (destroyed during cloning)
  • 3′ cloning site EcoR1 (unknown if destroyed)
  • 5′ sequencing primer pLKO-r
  • 3′ sequencing primer TAG TTT GTA TGT CTG TTG CTA TTA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shGLDC-DOX was a gift from David Sabatini (Addgene plasmid # 72883 ; http://n2t.net/addgene:72883 ; RRID:Addgene_72883)
  • For your References section:

    SHMT2 drives glioma cell survival in ischaemia but imposes a dependence on glycine clearance. Kim D, Fiske BP, Birsoy K, Freinkman E, Kami K, Possemato RL, Chudnovsky Y, Pacold ME, Chen WW, Cantor JR, Shelton LM, Gui DY, Kwon M, Ramkissoon SH, Ligon KL, Kang SW, Snuderl M, Vander Heiden MG, Sabatini DM. Nature. 2015 Apr 16;520(7547):363-7. doi: 10.1038/nature14363. Epub 2015 Apr 8. 10.1038/nature14363 PubMed 25855294