PMXS-GOT1
(Plasmid #72872)

• Purpose: The retroviral GOT1 vector was generated by cloning an sgRNA resistant human GOT1 gene block into the pMXS-ires-blast vector by Gibson Assembly.
• Depositing Lab: David Sabatini
• Publication: Birsoy et al Cell. 2015 Jul 30;162(3):540-51. doi: 10.1016/j.cell.2015.07.016.

Backbone

• Vector backbone: pMXs-IRES-blasticidin
• Backbone size w/o insert (bp): 5639
• Total vector size (bp): 6882
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GOT1
• Alt name: AST1; cCAT; GIG18; cAspAT; ASTQTL1
• Species: H. sapiens (human)
• Insert Size (bp): 1242
• Mutation: sgRNA resistant human GOT1, 7 silent mutations c138t, t141c, c144a, c657t,c660a,c663t,c669t
• GenBank ID: NM_002079.2
• Entrez Gene: GOT1 (a.k.a. AST, AST1, ASTQTL1, GIG18, SGOT, cAspAT, cCAT)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCCGGATCTAGCTAGTTAATTAAG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

It is a retroviral plasmid so it may be recommended to be propagated at 30oc but author typically grows it at 37oC.