pKF295
(Plasmid #72871)

• Purpose: expression of improved FLP recombinase
• Depositing Lab: Klaus Foerstemann
• Publication: Kunzelmann et al G3 (Bethesda). 2016 Jun 1;6(6):1777-85. doi: 10.1534/g3.116.028241.

Backbone

• Vector backbone: pCASPER
• Backbone size w/o insert (bp): 10090
• Total vector size (bp): 11362
• Modifications to backbone: contains ubi63E promoter and a SV40 polyA-signal
• Vector type: Insect Expression
• Selectable markers: mini-white

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FLP recombinase
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1272
• Mutation: P2->S, added NLS
• Entrez Gene: flp

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHi (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: tcccatttttattccccagccag
• 3′ sequencing primer: TGATCAGATAAGTTCAATGATATCCA

Resource Information

• Supplemental Documents:
  • Genomic Tagging in Drosophila cells (C-terminal constructs)
  • Genomic Tagging in Drosophila cells (N-terminal constructs)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

this vector is very similar to pMH5 (addgene 52531) but contains an activating point mutation (P2->S) and an additional N-terminal NLS