PatoM-LOG241
(Plasmid
#72847)
-
PurposeInduced by acetoacetate to express GFP using atoSC two-component system in E. coli. Contains the atoDAEB promoter (Pato) with a strong RBS, Shine-Dalgarno sequence provided in OG241. LOG241 backbone.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72847 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLOG241
- Total vector size (bp) 6144
-
Modifications to backboneInserted PatoM promoter, atoDAEB promoter (Pato) with a strong RBS (Shine-Dalgarno sequence provided in OG241), upstream daGFP.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePatoM
-
SpeciesE. coli DH5A
-
Insert Size (bp)540
- Promoter PatoM
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAAGCAACTAGTGCCGTGCATTGATGTATAAACT
- 3′ sequencing primer TGCTTAGAATTCTGCATACACCGTTGTGGGTACAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2016/01/07/035972 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PatoM-LOG241 was a gift from Chris Barnes (Addgene plasmid # 72847 ; http://n2t.net/addgene:72847 ; RRID:Addgene_72847) -
For your References section:
Engineered acetoacetate-inducible whole-cell biosensors based on the AtoSC two-component system. Rutter JW, Dekker L, Fedorec AJH, Gonzales DT, Wen KY, Tanner LES, Donovan E, Ozdemir T, Thomas GM, Barnes CP. Biotechnol Bioeng. 2021 Nov;118(11):4278-4289. doi: 10.1002/bit.27897. Epub 2021 Aug 9. 10.1002/bit.27897 PubMed 34289076