PatoK-OG241
(Plasmid
#72840)
-
PurposeNOT induced by acetoacetate to express GFP. Contains the native atoDAEB promoter (Pato) from E. coli DH5A, but out-of-frame with GFP gene. OG241 backbone.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72840 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneOG241
-
Backbone manufacturerOxford Genetics
- Total vector size (bp) 4718
-
Modifications to backboneInserted PatoK promoter upstream daGFP, but start codon is out-of-frame with daGFP.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePatoK
-
SpeciesE. coli DH5A
-
Insert Size (bp)575
- Promoter PatoK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer TAAGCAACTAGTGCCGTGCATTGATGTATAAACT
- 3′ sequencing primer TGCTTAGGTACCTGGCGTCTTGTAATGTCAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Capillary sequence files used the primers CATCTTCGATGGATAGCGATT and TGTACGGGATCTCCTTCTCG to verify MCS region including the promoter and the start codon of daGFP.
Please visit https://www.biorxiv.org/content/early/2016/01/07/035972 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PatoK-OG241 was a gift from Chris Barnes (Addgene plasmid # 72840 ; http://n2t.net/addgene:72840 ; RRID:Addgene_72840) -
For your References section:
Engineered acetoacetate-inducible whole-cell biosensors based on the AtoSC two-component system. Rutter JW, Dekker L, Fedorec AJH, Gonzales DT, Wen KY, Tanner LES, Donovan E, Ozdemir T, Thomas GM, Barnes CP. Biotechnol Bioeng. 2021 Nov;118(11):4278-4289. doi: 10.1002/bit.27897. Epub 2021 Aug 9. 10.1002/bit.27897 PubMed 34289076