AAVS1 T2 CRIPR in pX330
(Plasmid #72833)

• Purpose: CRISPR/Cas to target the AAVS1 locus in human cells
• Depositing Lab: Masato Kanemaki
• Publication: Natsume et al Cell Rep. 2016 Apr 5;15(1):210-8. doi: 10.1016/j.celrep.2016.03.001. Epub 2016 Mar 24.

Backbone

• Vector backbone: pX330
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9 and gRNA for targeting the AAVS1 locus in human cells
• gRNA/shRNA sequence: GGGGCCACTAGGGACAGGAT
• Species: H. sapiens (human)
• Promoter: U6 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: aggctgttagagagataattgg

Resource Information

• Supplemental Documents:
  • AAVS1 T2 CRIPR in pX330
• Articles Citing this Plasmid:
  • 26 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is based on pX330-U6-Chimeric_BB-CBh-hSpCas9 from Dr. Feng Zhang (Addgene #42230)(Cong et al, Science, 2013). The AAVS1 target sequence is described in Mali et al (Mali et al, Science, 2013).