FCIV1-GR
(Plasmid
#72701)
-
PurposeLentiviral expression of rat GR (2nd generation)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72701 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneFCIV1
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGR
-
Alt nameNR3C1
-
Alt namenuclear receptor subfamily 3, group C, member 1
-
SpeciesR. norvegicus (rat)
-
Entrez GeneNr3c1 (a.k.a. GR, Gcr, Grl)
- Promoter ubiquitin
-
Tag
/ Fusion Protein
- IRES-Venus (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer FCIV1-5 (gttagacgaagcttgggctgcaggtcgac)
- 3′ sequencing primer EGFP-N (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FCIV1-GR was a gift from Freddy Jeanneteau (Addgene plasmid # 72701 ; http://n2t.net/addgene:72701 ; RRID:Addgene_72701) -
For your References section:
Brain-derived neurotrophic factor signaling rewrites the glucocorticoid transcriptome via glucocorticoid receptor phosphorylation. Lambert WM, Xu CF, Neubert TA, Chao MV, Garabedian MJ, Jeanneteau FD. Mol Cell Biol. 2013 Sep;33(18):3700-14. doi: 10.1128/MCB.00150-13. Epub 2013 Jul 22. 10.1128/MCB.00150-13 PubMed 23878391