Skip to main content
Addgene

pSAM2_mCherry_Mesp1
(Plasmid #72687)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72687 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSAM2_GW_mCherry
  • Backbone size w/o insert (bp) 11391
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mesp 1
  • Species
    H. sapiens (human)
  • Entrez Gene
    MESP1 (a.k.a. bHLHc5)
  • Promoter CMV-Doxycycline

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pSAM 2 SEQ F - 5' GCTCGTTTAGTGAACCGTCAG 3'
  • 3′ sequencing primer pSAM2 SEQ R - 5' GAGGAACTGCTTCCTTCACG 3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSAM2_mCherry_Mesp1 was a gift from Timothy Kamp (Addgene plasmid # 72687 ; http://n2t.net/addgene:72687 ; RRID:Addgene_72687)
  • For your References section:

    Lineage Reprogramming of Fibroblasts into Proliferative Induced Cardiac Progenitor Cells by Defined Factors. Lalit PA, Salick MR, Nelson DO, Squirrell JM, Shafer CM, Patel NG, Saeed I, Schmuck EG, Markandeya YS, Wong R, Lea MR, Eliceiri KW, Hacker TA, Crone WC, Kyba M, Garry DJ, Stewart R, Thomson JA, Downs KM, Lyons GE, Kamp TJ. Cell Stem Cell. 2016 Mar 3;18(3):354-67. doi: 10.1016/j.stem.2015.12.001. Epub 2016 Feb 11. 10.1016/j.stem.2015.12.001 PubMed 26877223