tet-pLKO shGATA6 puro
(Plasmid
#72615)
-
PurposeExpresses an inducible short hairpin targeting human GATA6 sequence
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72615 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneTet PLKO puro
-
Backbone manufacturerPlasmid #21915
- Backbone size w/o insert (bp) 10633
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshort hairpin GATA binding protein 6
-
Alt nameshGATA6
-
gRNA/shRNA sequenceCCCAGACCACTTGCTATGAAA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_005257
- Promoter TRE Tight
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site ECORI (not destroyed)
- 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tet-pLKO shGATA6 puro was a gift from Kevin Janes (Addgene plasmid # 72615 ; http://n2t.net/addgene:72615 ; RRID:Addgene_72615) -
For your References section:
TNF-insulin crosstalk at the transcription factor GATA6 is revealed by a model that links signaling and transcriptomic data tensors. Chitforoushzadeh Z, Ye Z, Sheng Z, LaRue S, Fry RC, Lauffenburger DA, Janes KA. Sci Signal. 2016 Jun 7;9(431):ra59. doi: 10.1126/scisignal.aad3373. 10.1126/scisignal.aad3373 PubMed 27273097