Skip to main content
Addgene

pLL3.7-TNFa-shRNA3
(Plasmid #72598)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 72598 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pLL3.7
  • Backbone size w/o insert (bp) 7650
  • Total vector size (bp) 7692
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse TNF-alpha shRNA
  • gRNA/shRNA sequence
    TNF-alpha
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_013693
  • Entrez Gene
    Tnf (a.k.a. DIF, TNF-a, TNF-alpha, TNFSF2, TNFalpha, Tnfa, Tnfsf1a, Tnlg1f)
  • Promoter mouse U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer AGACTTGTGGGAGAAGCTCG
  • 3′ sequencing primer GGGTGAGTTTCCTTTTGTGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL3.7-TNFa-shRNA3 was a gift from Kazuhiro Oka (Addgene plasmid # 72598 ; http://n2t.net/addgene:72598 ; RRID:Addgene_72598)

  • For your References section:

    Gene therapy for neuropathic pain by silencing of TNF-alpha expression with lentiviral vectors targeting the dorsal root ganglion in mice. Ogawa N, Kawai H, Terashima T, Kojima H, Oka K, Chan L, Maegawa H. PLoS One. 2014 Mar 18;9(3):e92073. doi: 10.1371/journal.pone.0092073. eCollection 2014. PONE-D-13-38046 [pii] PubMed 24642694
Related items:
Commonly requested with: