pRK5-myc-PICK1-rescue
(Plasmid
#72573)
-
PurposeExpresses myc-PICK1 shRNA resistant cDNA
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72573 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRK5
- Backbone size w/o insert (bp) 5307
- Total vector size (bp) 6555
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePICK1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1248
-
Mutation5 silent mutations around shRNA recognition sequence
-
GenBank IDNM_053460.1
-
Entrez GenePick1 (a.k.a. Prkcabp)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggtgacactatagaataacatccac
- 3′ sequencing primer cccgatcgatccagacatgataag (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK5-myc-PICK1-rescue was a gift from Victor Anggono & Richard Huganir (Addgene plasmid # 72573 ; http://n2t.net/addgene:72573 ; RRID:Addgene_72573) -
For your References section:
PICK1 loss of function occludes homeostatic synaptic scaling. Anggono V, Clem RL, Huganir RL. J Neurosci. 2011 Feb 9;31(6):2188-96. doi: 10.1523/JNEUROSCI.5633-10.2011. 10.1523/JNEUROSCI.5633-10.2011 PubMed 21307255