Skip to main content
Addgene

shGFP neo
(Plasmid #72571)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72571 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLKO.1 neo
  • Backbone manufacturer
    Sheila Stewart
  • Backbone size w/o insert (bp) 7200
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • gRNA/shRNA sequence
    GCAAGCTGACCCTGAAGTTCAT

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer NA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shGFP neo was a gift from Kevin Janes (Addgene plasmid # 72571 ; http://n2t.net/addgene:72571 ; RRID:Addgene_72571)

  • For your References section:

    Network Architecture Predisposes an Enzyme to Either Pharmacologic or Genetic Targeting. Jensen KJ, Moyer CB, Janes KA. Cell Syst. 2016 Feb 24;2(2):112-121. 10.1016/j.cels.2016.01.012 PubMed 26942229
Related items:
Commonly requested with: