pTRC-APEX2
(Plasmid #72558)

• Purpose: Expression of cytosolic APEX2 in bacteria
• Depositing Lab: Alice Ting
• Publication: Lam et al Nat Methods. 2014 Nov 24. doi: 10.1038/nmeth.3179.

Backbone

• Vector backbone: pTRC
• Backbone size w/o insert (bp): 2282
• Total vector size (bp): 1509
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For expression and purification from bacterial cells, it is recommended to supplement cultures with 1 mM 5-aminolevulinic acid after induction with IPTG, with subsequent growth at room temperature to promote higher heme incorporation.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: APEX2
• Species: Soybean
• Mutation: A134P relative to APEX
• Tag / Fusion Protein:
  • His6 (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: AGCTGTTGACAATTAATCATCC

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry