hIL23p19 pEF6-V5 (MJS_004)
(Plasmid
#72492)
-
PurposeExpression of human IL23p19 in mammalian cells (V5 tag)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72492 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEF6/V5-His
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5840
- Total vector size (bp) 6411
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameIL23p19
-
Alt nameInterleukin 23 subunit alpha
-
Alt nameIl23A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)571
-
GenBank IDNM_016584.2
-
Entrez GeneIL23A (a.k.a. IL-23, IL-23A, IL23P19, P19, SGRF)
-
Tag
/ Fusion Protein
- His/V5 (C terminal on backbone)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hIL23p19 pEF6-V5 (MJS_004) was a gift from Matthew Sweet (Addgene plasmid # 72492 ; http://n2t.net/addgene:72492 ; RRID:Addgene_72492) -
For your References section:
TLR3 drives IRF6-dependent IL-23p19 expression and p19/EBI3 heterodimer formation in keratinocytes. Ramnath D, Tunny K, Hohenhaus DM, Pitts CM, Bergot AS, Hogarth PM, Hamilton JA, Kapetanovic R, Sturm RA, Scholz GM, Sweet MJ. Immunol Cell Biol. 2015 Oct;93(9):771-9. doi: 10.1038/icb.2015.77. Epub 2015 Aug 25. 10.1038/icb.2015.77 PubMed 26303210