pHLmMBP-10
(Plasmid #72348)

• Purpose: (Empty Backbone) Mammalian expression of secreted N-terminally 8His-tagged mMBP TEV cleavage site-linked fusion proteins with C-terminal 6His-tag/Strep-tag II/HA-tag
• Depositing Lab: Luca Jovine
• Publication: Bokhove et al J Struct Biol. 2016 Feb 3. 194:1-7. pii: S1047-8477(16)30015-6. doi: 10.1016/j.jsb.2016.01.016.

Backbone

• Vector backbone: pHLmMBP-10
• Backbone size (bp): 5931
• Vector type: Mammalian Expression
• Promoter: CMV enhancer + chicken beta-actin promoter
• Tags / Fusion Proteins:
  • 8His-tag (N terminal on backbone)
  • mMBP with C-terminal TEV cleavage site linker (N terminal on backbone)
  • 6His-tag (C terminal on backbone)
  • Strep-tag II (C terminal on backbone)
  • HA-tag (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: AAGGTGAAATCATGCCCAACATCC
• 3′ sequencing primer: ATTTGTGAGCCAGGGCATTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Prof. Dr. A. Radu Aricescu (pHLsec)
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cloning note: For cloning information, please refer to Figure S1 of the manuscript associated with this plasmid.

Mutagenesis note: Quikchange mutagenesis does not work efficiently on this family of plasmids.

Citation for pHLsec from which this plasmid is derived:
A time- and cost-efficient system for high-level protein production in mammalian cells
A. R. Aricescu, W. Lu and E. Y. Jones
Acta Cryst. D62:1243-1250 (2006)
PMID:17001101
doi:10.1107/S0907444906029799