Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHLmMBP-3
(Plasmid #72345)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72345 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHLmMBP-3
  • Backbone size (bp) 5877
  • Vector type
    Mammalian Expression
  • Promoter CMV enhancer + chicken beta-actin promoter
  • Tags / Fusion Proteins
    • 8His-tag (N terminal on backbone)
    • mMBP (N terminal on backbone)
    • 6His-tag (C terminal on backbone)
    • Strep-tag II (C terminal on backbone)
    • HA-tag (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer AAGGTGAAATCATGCCCAACATCC
  • 3′ sequencing primer ATTTGTGAGCCAGGGCATTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Prof. Dr. A. Radu Aricescu (pHLsec)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cloning note: For cloning information, please refer to Figure S1 of the manuscript associated with this plasmid.

Mutagenesis note: Quikchange mutagenesis does not work efficiently on this family of plasmids.

Citation for pHLsec from which this plasmid is derived:
A time- and cost-efficient system for high-level protein production in mammalian cells
A. R. Aricescu, W. Lu and E. Y. Jones
Acta Cryst. D62:1243-1250 (2006)
PMID:17001101
doi:10.1107/S0907444906029799

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHLmMBP-3 was a gift from Luca Jovine (Addgene plasmid # 72345 ; http://n2t.net/addgene:72345 ; RRID:Addgene_72345)
  • For your References section:

    Easy mammalian expression and crystallography of maltose-binding protein-fused human proteins. Bokhove M, Sadat Al Hosseini H, Saito T, Dioguardi E, Gegenschatz-Schmid K, Nishimura K, Raj I, de Sanctis D, Han L, Jovine L. J Struct Biol. 2016 Feb 3. 194:1-7. pii: S1047-8477(16)30015-6. doi: 10.1016/j.jsb.2016.01.016. 10.1016/j.jsb.2016.01.016 PubMed 26850170