pCH8
(Plasmid
#72306)
-
PurposepLlac* reporter plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72306 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePMB1+ROP
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Growth instructionsShow YFP fluo. when IPTG added or no LacI existing.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemodified YFP
-
SpeciesSynthetic
-
Insert Size (bp)717
-
GenBank ID
- Promoter pLlac*
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gagaaaactagtatgcgtaaaggcgaagagctgttcac
- 3′ sequencing primer taggggaattctcatcatttgtacagttcatccataccatgc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
T203Y mutant from sfGFP
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCH8 was a gift from Matthew Bennett (Addgene plasmid # 72306 ; http://n2t.net/addgene:72306 ; RRID:Addgene_72306) -
For your References section:
SYNTHETIC BIOLOGY. Emergent genetic oscillations in a synthetic microbial consortium. Chen Y, Kim JK, Hirning AJ, Josic K, Bennett MR. Science. 2015 Aug 28;349(6251):986-9. doi: 10.1126/science.aaa3794. 10.1126/science.aaa3794 PubMed 26315440