Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCH8
(Plasmid #72306)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72306 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PMB1+ROP
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    Show YFP fluo. when IPTG added or no LacI existing.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    modified YFP
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • GenBank ID
  • Promoter pLlac*

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer gagaaaactagtatgcgtaaaggcgaagagctgttcac
  • 3′ sequencing primer taggggaattctcatcatttgtacagttcatccataccatgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

T203Y mutant from sfGFP

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCH8 was a gift from Matthew Bennett (Addgene plasmid # 72306 ; http://n2t.net/addgene:72306 ; RRID:Addgene_72306)
  • For your References section:

    SYNTHETIC BIOLOGY. Emergent genetic oscillations in a synthetic microbial consortium. Chen Y, Kim JK, Hirning AJ, Josic K, Bennett MR. Science. 2015 Aug 28;349(6251):986-9. doi: 10.1126/science.aaa3794. 10.1126/science.aaa3794 PubMed 26315440
Commonly requested with: