Skip to main content
Addgene

pJMK077: CaMKIIa QuasAr2-TS-GCaMP6f
(Plasmid #72304)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72304 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    FCK
  • Backbone manufacturer
    Pavel Osten
  • Backbone size w/o insert (bp) 9235
  • Total vector size (bp) 11528
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CaViar
  • Alt name
    QuasAr2 + GCaMP6f
  • Species
    Synthetic
  • Insert Size (bp)
    3907
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • TS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcctctttgccccacttaat
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJMK077: CaMKIIa QuasAr2-TS-GCaMP6f was a gift from Adam Cohen (Addgene plasmid # 72304 ; http://n2t.net/addgene:72304 ; RRID:Addgene_72304)

  • For your References section:

    Cardiotoxicity screening with simultaneous optogenetic pacing, voltage imaging and calcium imaging. Dempsey GT, Chaudhary KW, Atwater N, Nguyen C, Brown BS, McNeish JD, Cohen AE, Kralj JM. J Pharmacol Toxicol Methods. 2016 May 13. pii: S1056-8719(16)30044-2. doi: 10.1016/j.vascn.2016.05.003. 10.1016/j.vascn.2016.05.003 PubMed 27184445
Related items:
Commonly requested with: