pCDH-CMV4
(Plasmid #72284)

• Purpose: (Empty Backbone) Express gene of interest under CMV promoter. WPRE has been removed to increase the cloning capacity.
• Depositing Lab: Kazuhiro Oka
• Publication: lenti vector (unpublished)

Backbone

• Vector backbone: pCDH-CMV-MCS
• Backbone manufacturer: Systembio
• Backbone size (bp): 5644
• Modifications to backbone: ClaI/Sal fragment was replace with CMV promoter + new MCS
• Vector type: Mammalian Expression, Lentiviral
• Promoter: CMV promoter

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• 5′ sequencing primer: GGCACCAAAATCAACGGGAC
• 3′ sequencing primer: CTGGAATAGCTCAGAGGCCG

Resource Information

• Supplemental Documents:
  • pCDH-CMV4.gb
  • Lenti-Transfection (2nd generation)-2016
  • Plasmid_Addgene-2016-BCM_GVC_Oka
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

The depositor noted that the single nucleotide mismatch (C>T, bp2193) within the CMV promoter found in Addgene's quality control sequence does NOT affect plasmid function.