pCDH-EF1-Fon-tdTomato
(Plasmid
#72261)
-
PurposeExpress tdTomato when FLP is expressed by another vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72261 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDH-CMV-MCS
-
Backbone manufacturerSystembio
- Backbone size w/o insert (bp) 7133
-
Modifications to backboneClaI/SalI fragment was replaced with EF1 + new MCS
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametdTomato
-
SpeciesSynthetic
-
Insert Size (bp)1450
-
MutationT230I in tdTomato (please see depositor's comment below)
- Promoter elongation factor-1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GCACTTGATGTAATTCTCC
- 3′ sequencing primer CAACACCACGGAATTGTCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The depositor noted that the TdTomato T230I mutation found in Addgene's quality control sequence does NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-EF1-Fon-tdTomato was a gift from Kazuhiro Oka (Addgene plasmid # 72261 ; http://n2t.net/addgene:72261 ; RRID:Addgene_72261)