Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDH-EF1-Fon-tdTomato
(Plasmid #72261)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 72261 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDH-CMV-MCS
  • Backbone manufacturer
    Systembio
  • Backbone size w/o insert (bp) 7133
  • Modifications to backbone
    ClaI/SalI fragment was replaced with EF1 + new MCS
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tdTomato
  • Species
    Synthetic
  • Insert Size (bp)
    1450
  • Mutation
    T230I in tdTomato (please see depositor's comment below)
  • Promoter elongation factor-1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GCACTTGATGTAATTCTCC
  • 3′ sequencing primer CAACACCACGGAATTGTCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The depositor noted that the TdTomato T230I mutation found in Addgene's quality control sequence does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-EF1-Fon-tdTomato was a gift from Kazuhiro Oka (Addgene plasmid # 72261 ; http://n2t.net/addgene:72261 ; RRID:Addgene_72261)