pCDH-CB-FLPe-P2A-tdTomato
(Plasmid #72259)

• Purpose: Express FLPe and tdTomato under CB promoter
• Depositing Lab: Kazuhiro Oka
• Publication: lenti vector (unpublished)

Backbone

• Vector backbone: pCDH-CMV-MCS
• Backbone manufacturer: Systembio
• Backbone size w/o insert (bp): 6677
• Modifications to backbone: ClaI/SalI fragment was replaced with CB promoter + MCS
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FLPe-P2A-tdTomato
• Species: Synthetic
• Insert Size (bp): 2820
• Mutation: T230I in tdTomato (please see depositor's comment below)
• Promoter: CB promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGGTGGTGGTGCAAATCAAA
• 3′ sequencing primer: CAACACCACGGAATTGTCAG

Resource Information

• Supplemental Documents:
  • pCDH-CB-FLPe-P2A-
  • Lenti-Transfection (2nd generation)-2016
  • Plasmid_Addgene-2016-BCM_GVC_Oka

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The depositor noted that the TdTomato T230I mutation found in Addgene's quality control sequence does NOT affect plasmid function.