pTT3 Unc5C-FLAG
(Plasmid #72196)

• Purpose: Expresses full-length Unc5c with a C-terminal FLAG tag
• Depositing Lab: Woj Wojtowicz
• Publication: Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149.

Backbone

• Vector backbone: pTT3
• Backbone manufacturer: Yves Durocher, National Research Council of Canada-Biotechnology Research Institute
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Unc5c
• Alt name: Unc5h3; rcm
• Alt name: NCBI gene ID 22253; Reference sequence NM_009472.4
• Species: M. musculus (mouse)
• Insert Size (bp): 2823
• Entrez Gene: Unc5c (a.k.a. B130051O18Rik, Unc5h3, rcm)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CAGTTTCCAAAAACGAGGAGG
• 3′ sequencing primer: TATGTCCTTCCGAGTGAGAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry