Sema4c-Fc-His
(Plasmid #72156)

• Purpose: Expresses the extracellular region of the Sema4C protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.
• Depositing Lab: Woj Wojtowicz
• Publication: Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149.

Backbone

• Vector backbone: pCMVi-SV40ori
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sema4c
• Alt name: Semaphorin 4C; Semaf; Semai; Semacl1
• Alt name: NCBI gene ID 20353; Reference sequence NM_001126047.2
• Species: M. musculus (mouse)
• Insert Size (bp): 1992
• Entrez Gene: Sema4c (a.k.a. AI426163, M-Sema F, Semacl1, Semaf, Semai, sema I)
• Promoter: CMV
• Tag / Fusion Protein:
  • Fc-His (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: GTCAGAGGTAACTCCCGTTGC
• 3′ sequencing primer: ATCATGAGGGTGTCCTTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry