Ncam1_1.18.1-Fc-His
(Plasmid #72088)

• Purpose: Expresses the extracellular region of the NCAM1, isoform 1.18.1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.
• Depositing Lab: Woj Wojtowicz
• Publication: Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149.

Backbone

• Vector backbone: pCMVi-SV40ori
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ncam1_1.18.1
• Alt name: Neural cell adhesion molecule 1, isoform 1.18.1; CD56; Ncam; E-NCAM; NCAM-1
• Species: M. musculus (mouse)
• Insert Size (bp): 2154
• Entrez Gene: Ncam1 (a.k.a. CD56, E-NCAM, NCAM-1, Ncam)
• Promoter: CMV
• Tag / Fusion Protein:
  • Fc-His (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: GTCAGAGGTAACTCCCGTTGC
• 3′ sequencing primer: ATCATGAGGGTGTCCTTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There are 3 mini exons in Ncam. The first mini exon is called "exon Pi" or "VASE". It contains nucleotides that encode the amino acid sequence "ASWTRPEKQE". The second mini exon occurs between exons 13-14. It encodes the amino acid sequence "IALLHK". The third mini exon occurs between exons 14-15 and encodes one amino acid, Lys. Ncam1_1.18.1 contains all three mini exons.