Cntn4.2-Fc-His
(Plasmid #72068)

• Purpose: Expresses the entire Contactin 2, isoform 2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.
• Depositing Lab: Woj Wojtowicz
• Publication: Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149.

Backbone

• Vector backbone: pCMVi-SV40ori
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cntn4.2
• Alt name: Contactin 4, isoform 2; Axcam; BIG-2
• Alt name: NCBI gene ID 269784;
• Species: M. musculus (mouse)
• Insert Size (bp): 2115
• Entrez Gene: Cntn4 (a.k.a. 9630050B05, Axcam, BIG-2)
• Promoter: CMV
• Tag / Fusion Protein:
  • Fc-His (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: GTCAGAGGTAACTCCCGTTGC
• 3′ sequencing primer: ATCATGAGGGTGTCCTTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry