Cntn2-AP-His
(Plasmid #71940)

• Purpose: Expresses the extracellular region of the Contactin 2 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.
• Depositing Lab: Woj Wojtowicz
• Publication: Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 10.7554/eLife.08149.

Backbone

• Vector backbone: pCMVi-SV40ori
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cntn2
• Alt name: Contactin 2; Tax; TAG-1
• Alt name: NCBI gene ID 21367; Reference sequence NM_177129.5
• Species: M. musculus (mouse)
• Insert Size (bp): 3015
• Entrez Gene: Cntn2 (a.k.a. D130012K04Rik, TAG-1, TAG1, Tax)
• Promoter: CMV
• Tag / Fusion Protein:
  • AP-His (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: GTCAGAGGTAACTCCCGTTGC
• 3′ sequencing primer: GAGGTTCTTGGCGGCTGTC

Resource Information

• Supplemental Documents:
  • Annotated GenBank file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry