pMIR-31-Reporter
(Plasmid #71871)

• Purpose: Mammalian expression vector for the analysis of miR-31 activity
• Depositing Lab: Mien-Chie Hung
• Publication: Shen et al Nature. 2013 May 16;497(7449):383-7. doi: 10.1038/nature12080. Epub 2013 May 1.

Backbone

• Vector backbone: pMIR-REPORT Luciferase
• Backbone manufacturer: Applied Biosystems
• Backbone size w/o insert (bp): 6470
• Total vector size (bp): 6497
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Reverse complementary sequence of miR-31
• Alt name: miR-31 binding sequence
• gRNA/shRNA sequence: TAGGCAAGATGCTGGCATAGCTA
• Species: H. sapiens (human)
• Promoter: CMV
• Tag / Fusion Protein:
  • firefly luciferase (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: Luc-F
• 3′ sequencing primer: pRS-marker

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Human miR-31 binding site was generated by annealing of two oligos as described in the reference.